Search Results/Filters    

Filters

Year

Banks




Expert Group











Full-Text


Issue Info: 
  • Year: 

    2017
  • Volume: 

    10
  • Issue: 

    2
  • Pages: 

    65-75
Measures: 
  • Citations: 

    0
  • Views: 

    1073
  • Downloads: 

    0
Abstract: 

In this study 700 records from 501 Holstein heifers (born during 2006-2012) were used to investigate of reproductive performance. The linear model was employed for Analysis of Age at First Services (AFS), Age at First Calving (AFC) and Interval from First to Last services (IFL) and the Generalized Linear Model for Conception Rate (CR). Results showed that the herd on CR was significant but the difference of other traits were not significant among herds. Conception rate least square means were not significant among different seasons and service numbers. Season of birth had significant effect on AFC so that heifers born during winter had lower AFC than summer born heifers. Comparison of lest square means for reproductive parameters in the studied herds with optimum levels showed that the AFS, AFC and IFL in most herds were higher than optimum (p<0.05). Conception rate was suitable in all herds and even in one herd was higher than optimum that shows using high quality sperms and ideal estrus detection.

Yearly Impact: مرکز اطلاعات علمی Scientific Information Database (SID) - Trusted Source for Research and Academic Resources

View 1073

مرکز اطلاعات علمی Scientific Information Database (SID) - Trusted Source for Research and Academic ResourcesDownload 0 مرکز اطلاعات علمی Scientific Information Database (SID) - Trusted Source for Research and Academic ResourcesCitation 0 مرکز اطلاعات علمی Scientific Information Database (SID) - Trusted Source for Research and Academic ResourcesRefrence 0
Issue Info: 
  • Year: 

    2012
  • Volume: 

    20
  • Issue: 

    2 (40)
  • Pages: 

    327-339
Measures: 
  • Citations: 

    0
  • Views: 

    1173
  • Downloads: 

    0
Abstract: 

In order to study reproductive traits variation of Mentha genotypes, an experiment was conducted on 19 Mentha genotypes belonging to fives species in a randomized complete block design with 3 replications at Fozve Research Station of Isfahan Agricultural Resource Research Center. Pollen length and width, viable and dead pollen percentages, number of pollen per anther, number of female flowers, number of complete flower per main spike, number of self pollinated seeds, number of open pollinated seeds and number of cross pollinated seeds were recorded. Results showed significant differences between all of the studied traits. Based on correlation coefficient between the traits, the number of open pollinated seeds, self pollinated seeds and cross pollinated seeds increased by increasing the number of complete flower, length and width of pollen seed, the number of live pollen seed and the number of pollens in anther.Stepwise regression showed correlation between increasing of self pollination and open pollination seed yield with number of viable pollen percentage and number of pollens in anther.Cluster analysis on 19 genotypes classified the genotypes into 4 groups. Mean comparisons among the groups showed suitable variation. The results also showed crossing possibility between the studied species. In essence, there was enough variation between the genotypes to be used in breeding projects.

Yearly Impact: مرکز اطلاعات علمی Scientific Information Database (SID) - Trusted Source for Research and Academic Resources

View 1173

مرکز اطلاعات علمی Scientific Information Database (SID) - Trusted Source for Research and Academic ResourcesDownload 0 مرکز اطلاعات علمی Scientific Information Database (SID) - Trusted Source for Research and Academic ResourcesCitation 0 مرکز اطلاعات علمی Scientific Information Database (SID) - Trusted Source for Research and Academic ResourcesRefrence 0
Issue Info: 
  • Year: 

    2019
  • Volume: 

    29
  • Issue: 

    3
  • Pages: 

    61-70
Measures: 
  • Citations: 

    0
  • Views: 

    478
  • Downloads: 

    0
Abstract: 

Introduction: Neuropeptide Y (NPY) is a neurotransmitter that presents at high concentrations in the hypothalamus. Neuropeptide Y is one of the most abundant peptides in chicken's brain, which works as a neurotransmitter in many functions and behaviors. The first time, it was extracted from the pituitary hypothalamus of pigs. This neuropeptide stimulates appetite and affects reproductive hormones. It was showed that there is a significant association between NPY gene and growth and reproductive traits of animals. The aim of this study was to investigate NPY gene polymorphisms and their association with reproductive traits in indigenous turkeys of Iran. These traits were including total egg weight production, length of laying period, age at the first egg, and the weight of the first egg. Materials and methods: A hundred and twenty turkey hens were randomly chosen from turkey’ s breeding center of East Azerbaijan of Iran. They were recorded for the reproductive traits. The blood samples of the birds were taken from their wing veins and used for DNA extraction. DNA was isolated from each animal's blood samples using salting-out method (Miller et al 1999). A fragment of 725bp of NPY gene was amplified using designed specific primers. The forward and reversed primers were GAAGCGTACCCCTCCAAAC and CCCCTTTAAGCAGCACAGTC, respectively. PCR was performed in a final volume of 25 ml containing 2ml of DNA template, 1. 2 ml of each primer, 8. 1 ml water and 12. 5 ml master mix containing: dNTP, proofreading Taq polymerase, MgCl2, and 1x PCR buffer. Thereafter, the PCR was programmed as follows: an initial denaturation step at 94° C for 5 min, followed by 32 cycles of 94° C for 60 s, 56° C for 40 s, and 72° C for 45 s. A final extension step was performed at 72° C for 8 min. Electrophoresis of the amplicons was carried out on 1. 5% agarose gels, and the gels were visualized under ultraviolet light after 45 minutes in 85 Volt. It should be noted that PCR products were purified and sequenced by Bioneer Company. The polymorphisms of the NPY gene was identified by commercially sequencing the PCR products and aligning the sequences using BioEdit software. PopGen32 software was used to identify genotype and allele frequencies. The associations of polymorphisms or haplotypes with the traits were analyzed using the SAS GLM procedure. Multiple comparisons of Tukey’ s test were performed to find differences among means. Results and discussion: The results revealed four novel SNPs in the NPY gene, which has not been already reported in turkey. The detected polymorphisms were including T360G, C367A, T544A, and C552T. Results of statistical analysis showed that there was a significant association between T360G and total egg weight. The T allele was the favorable allele for total egg weight trait as the TT genotype significantly increased the weight of produced eggs. The polymorphism of A544T was significantly associated with egg weight and laying length. The AA genotype of A544T positively influenced both egg weight and laying length traits. Both SNPs were located in the intron region of the gene. Although intronic mutations are not capable of altering the synthesized protein structure and/or changing the function of the protein, they may affect the level of gene transcription. Additionally, it was proved that the intronic polymorphisms may affect the gene expression levels via influencing the splicing process. Several studies have already been revealed that the NPY gene polymorphism, especially on the promoter and 5'-UTR regions, affect the reproductive traits of chicken. There is another study that reported a significant association between the SNPs of intron 3 of the NPY gene with growth and body traits in cows. It has been proven that NPY neuron terminals directly end on GnRH neurons and NPY is synthesized prior to the release of GnRH. It then releases the follicular stimulating hormone (FSH) and the luteinizing hormone (LH) from the pituitary gland. It has been shown that NPY influences GnRH secretion via affecting Kisspeptin neurons, which consequently alter reproductive traits. Also, stimulating the secretion of the GnRH through the neuropeptide receptors can lead to early maturity in the chicken. On the other hand, it was revealed that stimulation of NPY neurons mediates an increase in energy intake and storage. Altering the NPY gene expression in the hypothalamus of birds resulted in changing energy status. Moreover, NPY has been shown to be a potent appetite stimulating agent in chickens. Specific NPY receptors (Y1 and Y5) have been reported to mediate NPY effects on feeding behavior in chickens. In order to continue laying eggs, turkey hens need a higher amount of available energy and nutrients. Investigations in humans also represented that polymorphisms in NPY influenced fatness in men and was linked to body weight, BMI, body fat prototype, and leptin levels (Ding 2005, Van 2006). Concentrations of NPY are prominent when body fat reservoirs are fully consumed, resulting in hunger enlargement (Kalra et al. 1991). Consequently, upon negative energy balance, NPY levels are anticipated to be elevated. In addition, NPY has been recognized as a major controller of leptin action in the hypothalamus, affecting the discharge of LH and somatotropin (Kalra et al. 1991). This study has pointed out considerable relationships among leptin and NPY SNP with vital intensification, fertility, and milk production characteristics (Clempson et al. 2010). Also, it is assumed to be the cause of augmenting body mass index (BMI) in two different Swedish statistical groups of normal and fat peoples (Ding et al. 2005). The-880I/D advocate region variant of NPY might impact body fat prototyping in non-obese Mexican Americans from Starr County (Bray et al 2000). Therefore, effect of NPY on appetite may influence the supply of nutrients and energy to be consumed for reproductive performance specially egg production traits. Conclusion: In conclusion, four novel polymorphisms were detected in intron 1 of Meleagrine NPY gene. The polymorphisms of the NPY gene may affect some of egg production traits. If these effects validate by investigating them in a larger or another turkey population, they can be considered in breeding programs of native turkey population in North-West of Iran.

Yearly Impact: مرکز اطلاعات علمی Scientific Information Database (SID) - Trusted Source for Research and Academic Resources

View 478

مرکز اطلاعات علمی Scientific Information Database (SID) - Trusted Source for Research and Academic ResourcesDownload 0 مرکز اطلاعات علمی Scientific Information Database (SID) - Trusted Source for Research and Academic ResourcesCitation 0 مرکز اطلاعات علمی Scientific Information Database (SID) - Trusted Source for Research and Academic ResourcesRefrence 0
Issue Info: 
  • Year: 

    2024
  • Volume: 

    55
  • Issue: 

    3
  • Pages: 

    565-581
Measures: 
  • Citations: 

    0
  • Views: 

    38
  • Downloads: 

    4
Abstract: 

The aim of this study was to identify Single Nucleotide Polymorphism (SNP) associated with selected reproductive traits in Holstein dairy cattle. The interval between calving and the first insemination, days open, the interval between the first and last insemination, and the number of inseminations per pregnancy were analyzed. For this purpose, the hair samples of 150 cattle, born between 2012-2014 in one of the cattle farms of Ferdous Pars company, were used for genotyping based on 30108 SNPs chip. The data were analyzed using the least square variance analysis method using the GLM. GWAS analysis was performed after controlling the quality of the data. The results identified that 2 and 12 SNPs had a significant correlation with calving to insemination interval and interval between first to last insemination traits(p<0.04), respectively. In addition, 11 SNPs and 5 SNPs showed significant correlation for days open and the number of insemination per conception traits (p<0.04), respectively. In the Post-GWAS stage, some Quantitative Trait Loci (QTL) and various genes were identified that affected or controlled the trait. Out of the related NUF2 gene on chromosome 3 affects the development of the oocyte, ANAPC1 gene on chromosome 11, which affects sperm motility, PITX2 gene in chromosome 6, affects milk production and ELOVL6 gene on chromosome 6 affects body weight. In general, it can be concluded that chromosomes 3, 6 and 11 have SNPs that are more strongly related to reproductive traits.

Yearly Impact: مرکز اطلاعات علمی Scientific Information Database (SID) - Trusted Source for Research and Academic Resources

View 38

مرکز اطلاعات علمی Scientific Information Database (SID) - Trusted Source for Research and Academic ResourcesDownload 4 مرکز اطلاعات علمی Scientific Information Database (SID) - Trusted Source for Research and Academic ResourcesCitation 0 مرکز اطلاعات علمی Scientific Information Database (SID) - Trusted Source for Research and Academic ResourcesRefrence 0
Author(s): 

TOGHIANI S.

Journal: 

VIRTUAL

Issue Info: 
  • Year: 

    621
  • Volume: 

    1
  • Issue: 

    1
  • Pages: 

    458-468
Measures: 
  • Citations: 

    1
  • Views: 

    157
  • Downloads: 

    0
Keywords: 
Abstract: 

Yearly Impact: مرکز اطلاعات علمی Scientific Information Database (SID) - Trusted Source for Research and Academic Resources

View 157

مرکز اطلاعات علمی Scientific Information Database (SID) - Trusted Source for Research and Academic ResourcesDownload 0 مرکز اطلاعات علمی Scientific Information Database (SID) - Trusted Source for Research and Academic ResourcesCitation 1 مرکز اطلاعات علمی Scientific Information Database (SID) - Trusted Source for Research and Academic ResourcesRefrence 0
Issue Info: 
  • Year: 

    2023
  • Volume: 

    18
  • Issue: 

    4
  • Pages: 

    389-395
Measures: 
  • Citations: 

    0
  • Views: 

    44
  • Downloads: 

    0
Abstract: 

Improvement of reproductive traits, in addition to the effect on herd reproduction, can be effect on treatment and veterinary costs, animal welfare, and most importantly, profitability. While today, reproduction problems are one of the main reasons for the lack of profitability in dairy cattle herds. The purposes of this study was to Genome Wide association study (GWAS) of Age at First Insemination (AFI) and Age at First Calving (AFC) traits and the Number of Inseminations per Conception (NIPC) in Holstein heifers.In order to conduct this study, the record of 150 heifers born between 1390-1392 was used based on the breeding value of milk production. The results showed that 5 SNPs were significanteffect on age at first insemination (pValue<0.04). which was observed in BTA3(2), BTA5(2), BTA15(2), BTA21, BTA23, BTA28 and BTA30 regions respectively. For the age at first calving, 10 SNPs has a high correlation (pValue<0.04) which was located on BTA3(2), BTA5(2), BTA15(2), BTA21, BTA23, BTA28 and BTA30 regions respectively. 11 SNPs had a high correlation (pValue<0.04) for the Number of Inseminations per Conception and were able to be above the significant threshold line, which were located in BTA11, BTA8, BTA28, BTA6(5), BTA13, BTA18 and BTA14. QTLs identified in the margins of significant SNPs, with body weight trait; calving difficulty, calf weight and heifer maturity age were related. Finally, the QTLs identified in the margins of significant SNPs confirm the fact that the age of the first insemination and the age of the first calving can be effective on production traits, reproduction, longevity and finally on the profitability of the herd. In this situation, it can be said that herd management has a significant role in advancing breeding goals.

Yearly Impact: مرکز اطلاعات علمی Scientific Information Database (SID) - Trusted Source for Research and Academic Resources

View 44

مرکز اطلاعات علمی Scientific Information Database (SID) - Trusted Source for Research and Academic ResourcesDownload 0 مرکز اطلاعات علمی Scientific Information Database (SID) - Trusted Source for Research and Academic ResourcesCitation 0 مرکز اطلاعات علمی Scientific Information Database (SID) - Trusted Source for Research and Academic ResourcesRefrence 0
Issue Info: 
  • Year: 

    2021
  • Volume: 

    12
  • Issue: 

    33
  • Pages: 

    151-161
Measures: 
  • Citations: 

    0
  • Views: 

    64
  • Downloads: 

    0
Abstract: 

Growth and reproductive traits are well-known characteristics of living organisms because of their direct relationship with economic benefits. Genetic description of the growth curve and the correlation of its parameters with growth and reproductive traits can be useful in determining selection strategies. For this purpose, 2035 quail data, which were collected during the years 1398-1396 in the Agricultural Research and Training Center and Natural Resources of Khorasan Razavi, were used. To identify the fixed factors affecting the traits, the linear model of GLM procedure of SAS software was used and to estimate the parameters of the growth curve, the nonlinear regression model of Gampertz was used. Genetic components variance (co) of growth curve and reproduction traits was estimated using maximum likelihood multi-trait analysis by DMU software. Heritability of body weight at 35 days (BW35), asymptotic weight (a), maturity rate (k), age at inflection point (IPT), absolute growth rate (AGR), relative growth rate (RGR), number of eggs (EN) and fertility percentage (FR) were estimated respectively 0. 222, 0. 238, 0. 416, 0. 283, 168 to be 0. 22, 0. 222, 0. 283 and 0. 071. Growth curve parameters with AGR and RGR and BW35 days had high genetic correlations (0. 434-0. 924). The strongest correlation was obtained between IPT and RGR (0. 924). Except for genetic correlations between EN and FR percentage with other traits, most of the genetic correlations were positive. Based on this results, management of environmental factors are effective in increasing growth and reproductive performance, and genetic selection for growth trait using growth curve parameters can improve the genetic potential of the animals.

Yearly Impact: مرکز اطلاعات علمی Scientific Information Database (SID) - Trusted Source for Research and Academic Resources

View 64

مرکز اطلاعات علمی Scientific Information Database (SID) - Trusted Source for Research and Academic ResourcesDownload 0 مرکز اطلاعات علمی Scientific Information Database (SID) - Trusted Source for Research and Academic ResourcesCitation 0 مرکز اطلاعات علمی Scientific Information Database (SID) - Trusted Source for Research and Academic ResourcesRefrence 0
Issue Info: 
  • Year: 

    2021
  • Volume: 

    9
  • Issue: 

    2
  • Pages: 

    41-49
Measures: 
  • Citations: 

    0
  • Views: 

    53
  • Downloads: 

    2
Abstract: 

The objective of this study was to estimate genetic, phenotypic and residual correlations between ewe reproductive and lamb weight traits in D’man sheep. Data used in this study were 1804 reproductive and weight records collected between 1988 and 2015 from 530 replacement females, born from 82 sires and 298 dams. The ewe reproductive traits included litter size and litter weight at birth (LSB and LWB) and at 90 days (LSW and LWW) per ewe lambing and mating weight (MW), while the lamb weight traits investigated were weights at birth (BW), 90 (WW) and 135 (W135) days. Covariance components between the reproductive traits on the one hand and the weight traits on the other hand were estimated using bivariate analyses by employing the animal model that was deemed to be most appropriate from the univariate analyses for each trait. The genetic correlations between litter traits and body weights were low and in general not significantly different from zero ranging from -0.12 to 0.11, whereas those between ewe MW and lamb weights were positive and moderate varying from 0.16 to 0.51. The corresponding phenotypic correlations were slightly lower and varied from -0.04 between LSW and WW to 0.12 between LWW and BW and between LSW and W135. The residual correlations were in general similar to genetic correlations, except those between MW and body weights that were lower. It was concluded that selection for a genetic improvement in either of reproductive and weight traits would have little effect on genetic response in the other trait.

Yearly Impact: مرکز اطلاعات علمی Scientific Information Database (SID) - Trusted Source for Research and Academic Resources

View 53

مرکز اطلاعات علمی Scientific Information Database (SID) - Trusted Source for Research and Academic ResourcesDownload 2 مرکز اطلاعات علمی Scientific Information Database (SID) - Trusted Source for Research and Academic ResourcesCitation 0 مرکز اطلاعات علمی Scientific Information Database (SID) - Trusted Source for Research and Academic ResourcesRefrence 0
Issue Info: 
  • Year: 

    2010
  • Volume: 

    17
  • Issue: 

    1
  • Pages: 

    45-59
Measures: 
  • Citations: 

    0
  • Views: 

    972
  • Downloads: 

    0
Abstract: 

This experiment was carried to find out the effects of foliar fertilization and growing media on some of vegetative and reproductive traits of the new vegetable pepino (Solanum muricatum) in a pot culture in outdoor space during five month period in Mashhad. Foliar fertilization treatments were used in this study including foliar fertilization once every three weeks, once a week and control (no foliar fertilization). Media treatments also included soil, soil mixed with vermicompost, soil mixed with sand, soil mixed with peat moss and a mixture of soil, sand and peat moss. This experiment was conducted in a factorial (3x5) based on a completely randomized design with 6 replications. Traits such as number of shoots, leaf area, number of flower per bush and number of fruits per bush were measured by the stage of ripening fruits. The results showed that the foliar fertilization and media treatments in all of traits except for the effect of media on leaf area were significant different. In foliar fertilization treatments, the treatment of once every three weeks Resulted in significant increas in comparison to the control (P<0.01) and compared to the treatment of once a week showed significant increase in the number of shoots and number of fruit (P<0.01). Foliar fertilization treatment once a week compared to the control except for the number of fruits has also significant increase in all traits (P<0.01). In the growing media, treatment on vegetative and reproductive traits of pepino, the mixed of soil and peat moss showed significant increase in comparison to soil at %1 level on the traits such as number of shoots, number of flowers and number of fruits. This growing media also has significant effect on the traits of number of shoots and number of fruits compared to the mixture of soil, sand and peat moss as well as soil mixed with sand (P<0.01). Effect of growing media on leaf area showed no significant difference.

Yearly Impact: مرکز اطلاعات علمی Scientific Information Database (SID) - Trusted Source for Research and Academic Resources

View 972

مرکز اطلاعات علمی Scientific Information Database (SID) - Trusted Source for Research and Academic ResourcesDownload 0 مرکز اطلاعات علمی Scientific Information Database (SID) - Trusted Source for Research and Academic ResourcesCitation 0 مرکز اطلاعات علمی Scientific Information Database (SID) - Trusted Source for Research and Academic ResourcesRefrence 7
Issue Info: 
  • Year: 

    2024
  • Volume: 

    12
  • Issue: 

    2
  • Pages: 

    69-76
Measures: 
  • Citations: 

    0
  • Views: 

    1
  • Downloads: 

    0
Abstract: 

This research aimed to conduct a genetic analysis of maternal imprinting effects on growth and reproductive characteristics in the Murciano-Granadina goats. Data for the present study were recorded between 2016 and 2022 on a farm in the Kerman province, Iran. Traits studied were body weight at birth (WB) and weaning (WW), pre-weaning average daily gain (ADG), Kleiber ratio (KR) and growth efficiency (GE). Reproduction traits were litter size at birth (LSB), litter size at weaning (LSW), total litter size at birth (TLWB) and total litter size at weaning (TLWW). An animal model was used to analyze the data. Comparison of the models with and without maternal imprinting effects was performed using Akaike's information criterion (AIC). Maternal imprinting had a significant impact on WB and LSW. The heritability estimates for maternal imprinting ( ) were 0.07±0.07 for WB and 0.07±0.02 for LSW. Accounting for maternal imprinting effects into the model resulted in a reduction of 2% and 56% in the direct heritability of WB and LSW, respectively. In addition, the value of  for WB was reduced by approximately 75%. The results implied that there are maternal imprinting effects on the WB and LSW of Murciano-Granadina goats. Hence, the genetic evaluation models for these traits should consider the effect of maternal imprinting effect.

Yearly Impact: مرکز اطلاعات علمی Scientific Information Database (SID) - Trusted Source for Research and Academic Resources

View 1

مرکز اطلاعات علمی Scientific Information Database (SID) - Trusted Source for Research and Academic ResourcesDownload 0 مرکز اطلاعات علمی Scientific Information Database (SID) - Trusted Source for Research and Academic ResourcesCitation 0 مرکز اطلاعات علمی Scientific Information Database (SID) - Trusted Source for Research and Academic ResourcesRefrence 0
litScript
email sharing button
telegram sharing button
whatsapp sharing button
linkedin sharing button
twitter sharing button
email sharing button
email sharing button
sharethis sharing button